HUGE

Gene/Protein Characteristic Table for KIAA2023

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06826
Accession No. :	AB095943
Description :	E3 ubiquitin-protein ligase SHPRH.
HUGO Gene Name :	SNF2 histone linker PHD RING helicase (SHPRH)
Clone Name :	ff05025 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 11657 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 7180 bp

Genome contig ID gi89161210r_146166085
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
ACTTTTAAAATATAATTAAAATAAACATCTGAGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAACTGATTATGAAATTCTGAGTTTAAAATAGGAATAAAATAATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 146266085 146318085 24 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1092 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW47838	98.1	SNF2 histone li...	Homo sapiens
Q149N8	98.1	E3 ubiquitin-pr...	Homo sapiens
AAI17687	98.0	SHPRH protein [...	Homo sapiens
AAO26201	97.8	SNF2 histone li...	Homo sapiens
XP_001172960	99.6	SNF2 histone li...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005818 23 97 PF00538 Histone H1/H5

IPR001965 245 294 PF00628 Zinc finger

IPR000330 303 450 PF00176 SNF2-related

HMMSmart IPR005818 21 87 SM00526 Histone H1/H5

IPR014001 112 460 SM00487 DEAD-like helicases

IPR001965 245 292 SM00249 Zinc finger

IPR001841 1017 1063 SM00184 Zinc finger

ProfileScan IPR001841 1017 1064 PS50089 Zinc finger

ScanRegExp IPR001965 246 291 PS01359 Zinc finger

IPR001841 1033 1042 PS00518 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005818	23	97	PF00538	Histone H1/H5
IPR001965	245	294	PF00628	Zinc finger
IPR000330	303	450	PF00176	SNF2-related
HMMSmart	IPR005818	21	87	SM00526	Histone H1/H5
IPR014001	112	460	SM00487	DEAD-like helicases
IPR001965	245	292	SM00249	Zinc finger
IPR001841	1017	1063	SM00184	Zinc finger
ProfileScan	IPR001841	1017	1064	PS50089	Zinc finger
ScanRegExp	IPR001965	246	291	PS01359	Zinc finger
IPR001841	1033	1042	PS00518	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACATCAGCAAGAAACGCAGTC

Primer_r
: AGGACTGCTTCTGAAACACTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	7180 bp
Genome contig ID	gi89161210r_146166085
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- ACTTTTAAAATATAATTAAAATAAACATCTGAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAACTGATTATGAAATTCTGAGTTTAAAATAGGAATAAAATAATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	146266085	146318085	24	99.4	Perfect prediction

Primer_f	: ACATCAGCAAGAAACGCAGTC
Primer_r	: AGGACTGCTTCTGAAACACTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA2023

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information