HUGE

Gene/Protein Characteristic Table for KIAA2016

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07685
Accession No. :	AB095936
Description :	T-cell lymphoma invasion and metastasis 2 isoform b.
HUGO Gene Name :
Clone Name :	pf04366 [Vector Info]
Source :	Human brain (hippocampus)
Note :	We replaced fk10510, former representative clones for KIAA2016 with pf04366. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 6971 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 592 bp

Genome contig ID gi89161210f_155095523
PolyA signal sequence
(AGTAAA,-19)
+----*----+----*----+----*----+----
CTCTGCCAAGCTGTATAGTAAAAGGAAAATAAGTC
Flanking genome sequence
(525025 - 525074)
----+----*----+----*----+----*----+----*----+----*
ACATCTGGTCATTGGCATTTGTATCGTCATTCTGTAAAGACAAAAGAGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 155195523 155620546 29 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1715 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92911	100.0	T-cell lymphoma...	Homo sapiens
Q8IVF5	100.0	T-lymphoma inva...	Homo sapiens
XP_527545	99.3	T-cell lymphoma...	Pan troglodytes
BAG53973	99.9	unnamed protein...	Homo sapiens
XP_419687	77.9	similar to T-ce...	Gallus gallus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037836	3.6e-07	27.7	KIAA1415
AB033082	4.9e-06	26.0	KIAA1256
AB007884	8.9e-06	26.2	KIAA0424
AB002335	1.2e-05	24.3	KIAA0337
AB002378	1.7e-05	21.2	KIAA0380

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 521 634 PF00169 Pleckstrin-like

IPR001478 904 985 PF00595 PDZ/DHR/GLGF

IPR000219 1117 1306 PF00621 DH

HMMSmart IPR001849 521 636 SM00233 Pleckstrin-like

IPR003116 824 895 SM00455 Raf-like Ras-binding

IPR001478 914 990 SM00228 PDZ/DHR/GLGF

IPR000219 1117 1306 SM00325 DH

IPR001849 1340 1471 SM00233 Pleckstrin-like

ProfileScan IPR001849 520 634 PS50003 Pleckstrin-like

IPR003116 824 895 PS50898 Raf-like Ras-binding

IPR001478 904 990 PS50106 PDZ/DHR/GLGF

IPR000219 1113 1307 PS50010 DH

ScanRegExp IPR001331 1255 1280 PS00741 Guanine-nucleotide dissociation stimulator

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	521	634	PF00169	Pleckstrin-like
IPR001478	904	985	PF00595	PDZ/DHR/GLGF
IPR000219	1117	1306	PF00621	DH
HMMSmart	IPR001849	521	636	SM00233	Pleckstrin-like
IPR003116	824	895	SM00455	Raf-like Ras-binding
IPR001478	914	990	SM00228	PDZ/DHR/GLGF
IPR000219	1117	1306	SM00325	DH
IPR001849	1340	1471	SM00233	Pleckstrin-like
ProfileScan	IPR001849	520	634	PS50003	Pleckstrin-like
IPR003116	824	895	PS50898	Raf-like Ras-binding
IPR001478	904	990	PS50106	PDZ/DHR/GLGF
IPR000219	1113	1307	PS50010	DH
ScanRegExp	IPR001331	1255	1280	PS00741	Guanine-nucleotide dissociation stimulator

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTTTTGCTTCCGACATTGATG

Primer_r
: GAGTCCTTCTTCGCAGTATCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	592 bp
Genome contig ID	gi89161210f_155095523
PolyA signal sequence (AGTAAA,-19)	+--------+--------+----*----+---- CTCTGCCAAGCTGTATAGTAAAAGGAAAATAAGTC
Flanking genome sequence (525025 - 525074)	----+--------+--------+--------+--------+----* ACATCTGGTCATTGGCATTTGTATCGTCATTCTGTAAAGACAAAAGAGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	155195523	155620546	29	99.8	Perfect prediction

Primer_f	: CTTTTGCTTCCGACATTGATG
Primer_r	: GAGTCCTTCTTCGCAGTATCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA2016

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information