| HUGE |
Gene/Protein Characteristic Table for KIAA2008 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01642 |
|---|---|
| Accession No. : | AB235153 |
| Description : | Alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase B. |
| HUGO Gene Name : | |
| Clone Name : | fj04470 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA2008
|
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4491 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1538 bp Genome contig ID gi51511734f_72276133 PolyA signal sequence
(AATAAA,-23)
ATTTCTTGAAATAATAAATATTTTATTGGGATGTGFlanking genome sequence
(181923 - 181972)
AGGTGCAGAAGAGGAACTGTGCTGGATTCTCGTCTTTTCCTGCGGCATCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 72376133 72458054 17 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 793 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : | |
| : | |
| : °C |
RH mapping information |
Description | |
|---|---|---|
| : |
| : | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
