| HUGE |
Gene/Protein Characteristic Table for KIAA1976 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05738 |
|---|---|
| Accession No. : | AB075856 |
| Description : | Netrin receptor UNC5A precursor. |
| HUGO Gene Name : | unc-5 homolog A (C. elegans) (UNC5A) |
| Clone Name : | fg02988 [Vector Info] |
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6495 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1615 bp Genome contig ID gi51511721f_176134009 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
GCGTGAATGTAAATAAATTATATATATATATTGCTFlanking genome sequence
(106496 - 106545) ----+----*----+----*----+----*----+----*----+----*
AACCTGAGTGCTACTTCTCTCAGGGAAAGCCAGGGAGCAAGGCCAAATGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 176234009 176240503 1 99.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 351 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GTTTTCTGTGCCTGAGCTAGC | |
| : AAGACTGCCGTGCTGACCAAC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 5 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |