HUGE

Gene/Protein Characteristic Table for KIAA1971

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00962
Accession No. :	AB075851
Description :	WAS protein homology region 2 domain containing 1.
HUGO Gene Name :	WAS protein homology region 2 domain containing 1 (WHDC1)
Clone Name :	fk08985 [Vector Info]
Flexi ORF Clone :	pF1KSDA1971
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3637 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1122 bp

Genome contig ID gi51511731f_81175448
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTATCAGTAATCAGAATAAATTGCTTATATTCAGG
Flanking genome sequence
(125018 - 125067)
----+----*----+----*----+----*----+----*----+----*
AGTTATTTTAAATATTTAAATGAAATTTATTTTAGGCACCAAGCACTACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 81275448 81300464 10 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 830 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8TF30	0	100.0	WASP homolog as...	Homo sapiens
XP_510552	0	98.4	WAS protein hom...	Pan troglodytes
XP_001927350	4.9e-182	77.8	WAS protein hom...	Sus scrofa
XP_001082027	1e-160	95.1	similar to WAS ...	Macaca mulatta
EDM08696	1.4e-148	66.8	similar to junc...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003124 760 777 PF02205 Actin-binding WH2

ProfileScan IPR003124 760 777 PS51082 Actin-binding WH2

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003124	760	777	PF02205	Actin-binding WH2
ProfileScan	IPR003124	760	777	PS51082	Actin-binding WH2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CGCCAGGTTATTCAAGGACAC

Primer_r
: AATGGCTGCAATAAGTACTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1122 bp
Genome contig ID	gi51511731f_81175448
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTATCAGTAATCAGAATAAATTGCTTATATTCAGG
Flanking genome sequence (125018 - 125067)	----+--------+--------+--------+--------+----* AGTTATTTTAAATATTTAAATGAAATTTATTTTAGGCACCAAGCACTACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	81275448	81300464	10	100.0	Perfect prediction

Primer_f	: CGCCAGGTTATTCAAGGACAC
Primer_r	: AATGGCTGCAATAAGTACTGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1971

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information