HUGE

Gene/Protein Characteristic Table for KIAA1970

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00961
Accession No. :	AB075850
Description :	Probable glutamyl-tRNA synthetase, mitochondrial precursor.
HUGO Gene Name :	glutamyl-tRNA synthetase 2, mitochondrial (putative) (EARS2)
Clone Name :	fk07936 [Vector Info]
Flexi ORF Clone :	pF1KSDA1970
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3110 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO
Ensembl ContigView (Add our DAS server as a DAS source)
Content-type: text/html ¥¨¥é¡¼¡ª

fk07936 ¤Î¾ðÊó¤¬¥Ç¡¼¥¿¥Ù¡¼¥¹¤Ë¤¢¤ê¤Þ¤»¤ó¤Ç¤·¤¿¡£

¤â¤É¤ë

Features of the protein sequence	Description

Length: 519 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI46121	0	99.8	hypothetical pr...	Homo sapiens
XP_001162700	0	99.0	glutamyl-tRNA s...	Pan troglodytes
AAH40013	2.5e-209	99.4	EARS2 protein [...	Homo sapiens
XP_001094523	1.5e-208	94.2	similar to CG45...	Macaca mulatta
XP_001162661	2.9e-208	98.6	glutamyl-tRNA s...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000924 36 48 PR00987 Glutamyl/glutaminyl-tRNA synthetase

IPR000924 50 61 PR00987 Glutamyl/glutaminyl-tRNA synthetase

IPR000924 65 78 PR00987 Glutamyl/glutaminyl-tRNA synthetase

IPR000924 222 232 PR00987 Glutamyl/glutaminyl-tRNA synthetase

IPR000924 238 246 PR00987 Glutamyl/glutaminyl-tRNA synthetase

HMMPfam IPR000924 32 349 PF00749 Glutamyl/glutaminyl-tRNA synthetase

HMMTigr IPR004527 32 519 TIGR00464 Glutamyl-tRNA synthetase

ScanRegExp IPR001412 39 50 PS00178 Aminoacyl-tRNA synthetase

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000924	36	48	PR00987	Glutamyl/glutaminyl-tRNA synthetase
IPR000924	50	61	PR00987	Glutamyl/glutaminyl-tRNA synthetase
IPR000924	65	78	PR00987	Glutamyl/glutaminyl-tRNA synthetase
IPR000924	222	232	PR00987	Glutamyl/glutaminyl-tRNA synthetase
IPR000924	238	246	PR00987	Glutamyl/glutaminyl-tRNA synthetase
HMMPfam	IPR000924	32	349	PF00749	Glutamyl/glutaminyl-tRNA synthetase
HMMTigr	IPR004527	32	519	TIGR00464	Glutamyl-tRNA synthetase
ScanRegExp	IPR001412	39	50	PS00178	Aminoacyl-tRNA synthetase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTGGAAACAATCTCTGACTGC

Primer_r
: AATGTGTGAGAAACCAGACCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Primer_f	: GTGGAAACAATCTCTGACTGC
Primer_r	: AATGTGTGAGAAACCAGACCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1970

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information