HUGE

Gene/Protein Characteristic Table for KIAA1959

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00956
Accession No. :	AB075839
Description :	Suppressor of T-cell receptor signaling 1.
HUGO Gene Name :	ubiquitin associated and SH3 domain containing, B (UBASH3B)
Clone Name :	hh03965 [Vector Info]
Flexi ORF Clone :	pF1KSDA1959
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4722 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2560 bp

Genome contig ID gi51511727f_121931756
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TACTCAATTTCATATACATCCAAAAAGTATAGGCT
Flanking genome sequence
(256609 - 256658)
----+----*----+----*----+----*----+----*----+----*
AATATATATAACCTGAAGTTGCAGCTGGTTCTTTTTGATCTGAAGCTGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 122031756 122188363 14 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 650 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8TF42	100.0	Ubiquitin assoc...	Homo sapiens
XP_508828	99.8	Cbl-interacting...	Pan troglodytes
XP_001107573	99.5	similar to Cbl-...	Macaca mulatta
BAD96563	99.7	Cbl-interacting...	Homo sapiens
XP_001917603	98.5	similar to Ubiq...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037717	0.00024	45.6	KIAA1296
AB018320	0.00055	38.0	KIAA0777
AB040927	0.00085	28.3	KIAA1494

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 261 315 PD000066 Src homology-3

HMMPfam IPR000449 37 77 PF00627 Ubiquitin-associated/Translation elongation factor EF1B

IPR001452 258 318 PF00018 Src homology-3

IPR013078 386 584 PF00300 Phosphoglycerate mutase

HMMSmart IPR000449 38 76 SM00165 Ubiquitin-associated/Translation elongation factor EF1B

IPR001452 258 319 SM00326 Src homology-3

ProfileScan IPR000449 28 77 PS50030 Ubiquitin-associated/Translation elongation factor EF1B

IPR001452 255 320 PS50002 Src homology-3

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	261	315	PD000066	Src homology-3
HMMPfam	IPR000449	37	77	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
IPR001452	258	318	PF00018	Src homology-3
IPR013078	386	584	PF00300	Phosphoglycerate mutase
HMMSmart	IPR000449	38	76	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
IPR001452	258	319	SM00326	Src homology-3
ProfileScan	IPR000449	28	77	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
IPR001452	255	320	PS50002	Src homology-3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGACCTCACATTCCAATCAGC

Primer_r
: ATTTGTACGAAGTCCTTGGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2560 bp
Genome contig ID	gi51511727f_121931756
PolyA signal sequence (None)	+--------+--------+----*----+---- TACTCAATTTCATATACATCCAAAAAGTATAGGCT
Flanking genome sequence (256609 - 256658)	----+--------+--------+--------+--------+----* AATATATATAACCTGAAGTTGCAGCTGGTTCTTTTTGATCTGAAGCTGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	122031756	122188363	14	99.4	Perfect prediction

Primer_f	: AGACCTCACATTCCAATCAGC
Primer_r	: ATTTGTACGAAGTCCTTGGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1959

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information