HUGE

Gene/Protein Characteristic Table for KIAA1957

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00955
Accession No. :	AB075837
Description :
HUGO Gene Name :
Clone Name :	fk12643 [Vector Info]
Flexi ORF Clone :	pF1KSDA1957
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 2976 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1505 bp

Genome contig ID gi42406306r_256447
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
AAATGCTGTTTATAGTGCAATAAAGGTGTTTCGGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATACGGGGGTGGAGGTTGGCTTCCCTGGCTGTTTAATAACGAGAGAGTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 356447 360170 3 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 481 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW61200	1.4e-159	97.9	hCG1659953, iso...	Homo sapiens
CAD39008	3.3e-137	100.0	hypothetical pr...	Homo sapiens
EDL89418	1.5e-129	90.5	rCG29198 [Rattu...	Rattus norvegicus
Q5HZI2	7.4e-129	90.5	Nuclear-localiz...	Mus musculus
BAC26694	5.5e-128	90.0	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000008 382 471 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR000008 381 481 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR000008 381 471 PS50004 C2 calcium-dependent membrane targeting

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	382	471	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	381	481	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	381	471	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTGTGTAAATAGGCTGTGGCT

Primer_r
: CATTCAAGGACCCACATAACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1505 bp
Genome contig ID	gi42406306r_256447
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- AAATGCTGTTTATAGTGCAATAAAGGTGTTTCGGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATACGGGGGTGGAGGTTGGCTTCCCTGGCTGTTTAATAACGAGAGAGTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	356447	360170	3	99.1	Perfect prediction

Primer_f	: GTGTGTAAATAGGCTGTGGCT
Primer_r	: CATTCAAGGACCCACATAACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1957

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information