HUGE

Gene/Protein Characteristic Table for KIAA1950

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01641
Accession No. :	AB075830
Description :	Archaemetzincin-1.
HUGO Gene Name :	archaelysin family metallopeptidase 1 (AMZ1)
Clone Name :	fj03308 [Vector Info]
Flexi ORF Clone :	pF1KSDA1950
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4415 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2557 bp

Genome contig ID gi89161213f_2585689
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
GGAGTGATGCGAGATTAAACAGAGGTGATAAAAAT
Flanking genome sequence
(135908 - 135957)
----+----*----+----*----+----*----+----*----+----*
AGAATGCCTGGCTCATGCTGAGGGTGGGAGCCCACTGGGGTTATGACCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 2685689 2721595 7 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 535 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001139882	0	96.6	archaemetzincin...	Pan troglodytes
XP_001087225	4.7e-197	94.0	similar to arch...	Macaca mulatta
XP_547006	1.2e-162	74.7	hypothetical pr...	Canis lupus fam...
Q400C9	1.5e-155	75.4	Archaemetzincin...	Rattus norvegicus
Q8BVF9	3.1e-152	73.5	Archaemetzincin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR006025 295 304 PS00142 Peptidase M

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR006025	295	304	PS00142	Peptidase M

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGTATGTGTCCGCCTTCTCCC

Primer_r
: GTAGGTAGATGTGCTTCCGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2557 bp
Genome contig ID	gi89161213f_2585689
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- GGAGTGATGCGAGATTAAACAGAGGTGATAAAAAT
Flanking genome sequence (135908 - 135957)	----+--------+--------+--------+--------+----* AGAATGCCTGGCTCATGCTGAGGGTGGGAGCCCACTGGGGTTATGACCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	2685689	2721595	7	99.2	Perfect prediction

Primer_f	: TGTATGTGTCCGCCTTCTCCC
Primer_r	: GTAGGTAGATGTGCTTCCGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1950

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information