HUGE

Gene/Protein Characteristic Table for KIAA1943

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05348
Accession No. :	AB075823
Description :	G-protein coupled receptor 98 precursor.
HUGO Gene Name :
Clone Name :	fh10956 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5047 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1880 bp

Genome contig ID gi51511721f_89860132
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATAGAAATCATTTACAATAAAAATCATTTACAATC
Flanking genome sequence
(127298 - 127347)
----+----*----+----*----+----*----+----*----+----*
ATTATAAGAATCATTTACAGTCATTCAGAGATAGCCACTATAAACATTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 89960131 89987428 13 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1054 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW95990	99.9	monogenic, audi...	Homo sapiens
EAW95994	99.8	monogenic, audi...	Homo sapiens
EAW95986	99.8	monogenic, audi...	Homo sapiens
EAW95991	99.8	monogenic, audi...	Homo sapiens
NP_115495	99.8	G protein-coupl...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040933	1.6e-06	21.7	KIAA1500

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003644 581 681 PF03160 Na-Ca exchanger/integrin-beta4

HMMSmart IPR003644 351 449 SM00237 Na-Ca exchanger/integrin-beta4

IPR003644 464 567 SM00237 Na-Ca exchanger/integrin-beta4

IPR003644 581 681 SM00237 Na-Ca exchanger/integrin-beta4

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003644	581	681	PF03160	Na-Ca exchanger/integrin-beta4
HMMSmart	IPR003644	351	449	SM00237	Na-Ca exchanger/integrin-beta4
IPR003644	464	567	SM00237	Na-Ca exchanger/integrin-beta4
IPR003644	581	681	SM00237	Na-Ca exchanger/integrin-beta4

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCTAGCAGAAACCAACCTCC

Primer_r
: TATTTCCCAGCCCAGTTGTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1880 bp
Genome contig ID	gi51511721f_89860132
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATAGAAATCATTTACAATAAAAATCATTTACAATC
Flanking genome sequence (127298 - 127347)	----+--------+--------+--------+--------+----* ATTATAAGAATCATTTACAGTCATTCAGAGATAGCCACTATAAACATTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	89960131	89987428	13	99.4	Perfect prediction

Primer_f	: AGCTAGCAGAAACCAACCTCC
Primer_r	: TATTTCCCAGCCCAGTTGTAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1943

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information