HUGE

Gene/Protein Characteristic Table for KIAA1942

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00951
Accession No. :	AB075822
Description :	Glutamate-rich WD repeat-containing protein 1.
HUGO Gene Name :
Clone Name :	fg00781 [Vector Info]
Flexi ORF Clone :	pF1KSDA1942
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5549 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4210 bp

Genome contig ID gi42406306f_53541077
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCCAGCTTGGGCGACAGAGCGAGACTCTGTCTCC
Flanking genome sequence
(115522 - 115571)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAATGCGTATCGTTCCACCTATTTGACAGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 53641077 53656597 8 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 445 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10184	8.7e-183	100.0	glutamate-rich ...	synthetic construct
Q9BQ67	2.1e-182	99.8	Glutamate-rich ...	Homo sapiens
CAD28519	4.2e-182	99.6	hypothetical pr...	Homo sapiens
BAG37993	4.2e-182	99.6	unnamed protein...	Homo sapiens
BAC11130	1.8e-181	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033068	2e-05	26.2	KIAA1242
AB023142	0.00053	28.2	KIAA0925

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001680 256 290 PD000018 WD40 repeat

FPrintScan IPR001680 276 290 PR00320 WD40 repeat

IPR001680 322 336 PR00320 WD40 repeat

IPR001680 368 382 PR00320 WD40 repeat

HMMPfam IPR001680 203 242 PF00400 WD40 repeat

IPR001680 250 289 PF00400 WD40 repeat

IPR001680 297 335 PF00400 WD40 repeat

IPR001680 342 381 PF00400 WD40 repeat

HMMSmart IPR001680 202 242 SM00320 WD40 repeat

IPR001680 248 289 SM00320 WD40 repeat

IPR001680 296 335 SM00320 WD40 repeat

IPR001680 341 381 SM00320 WD40 repeat

ProfileScan IPR001680 209 390 PS50294 WD40 repeat

IPR001680 256 291 PS50082 WD40 repeat

IPR001680 303 337 PS50082 WD40 repeat

IPR001680 348 382 PS50082 WD40 repeat

ScanRegExp IPR001680 322 336 PS00678 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	256	290	PD000018	WD40 repeat
FPrintScan	IPR001680	276	290	PR00320	WD40 repeat
IPR001680	322	336	PR00320	WD40 repeat
IPR001680	368	382	PR00320	WD40 repeat
HMMPfam	IPR001680	203	242	PF00400	WD40 repeat
IPR001680	250	289	PF00400	WD40 repeat
IPR001680	297	335	PF00400	WD40 repeat
IPR001680	342	381	PF00400	WD40 repeat
HMMSmart	IPR001680	202	242	SM00320	WD40 repeat
IPR001680	248	289	SM00320	WD40 repeat
IPR001680	296	335	SM00320	WD40 repeat
IPR001680	341	381	SM00320	WD40 repeat
ProfileScan	IPR001680	209	390	PS50294	WD40 repeat
IPR001680	256	291	PS50082	WD40 repeat
IPR001680	303	337	PS50082	WD40 repeat
IPR001680	348	382	PS50082	WD40 repeat
ScanRegExp	IPR001680	322	336	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAACAGACTGATGATGCTTCG

Primer_r
: GGTTTCCGCTCTTCTTCATCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4210 bp
Genome contig ID	gi42406306f_53541077
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCTTGGGCGACAGAGCGAGACTCTGTCTCC
Flanking genome sequence (115522 - 115571)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAATGCGTATCGTTCCACCTATTTGACAGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	53641077	53656597	8	99.0	Perfect prediction

Primer_f	: CAACAGACTGATGATGCTTCG
Primer_r	: GGTTTCCGCTCTTCTTCATCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1942

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information