HUGE |
Gene/Protein Characteristic Table for KIAA1942 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00951 |
---|---|
Accession No. : | AB075822 |
Description : | Glutamate-rich WD repeat-containing protein 1. |
HUGO Gene Name : | |
Clone Name : | fg00781 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1942
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5549 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4210 bp Genome contig ID gi42406306f_53541077 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CTCCAGCTTGGGCGACAGAGCGAGACTCTGTCTCCFlanking genome sequence
(115522 - 115571) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAATGCGTATCGTTCCACCTATTTGACAGAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 f 53641077 53656597 8 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 445 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001680 | 256 | 290 | PD000018 | WD40 repeat |
FPrintScan | IPR001680 | 276 | 290 | PR00320 | WD40 repeat |
IPR001680 | 322 | 336 | PR00320 | WD40 repeat | |
IPR001680 | 368 | 382 | PR00320 | WD40 repeat | |
HMMPfam | IPR001680 | 203 | 242 | PF00400 | WD40 repeat |
IPR001680 | 250 | 289 | PF00400 | WD40 repeat | |
IPR001680 | 297 | 335 | PF00400 | WD40 repeat | |
IPR001680 | 342 | 381 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 202 | 242 | SM00320 | WD40 repeat |
IPR001680 | 248 | 289 | SM00320 | WD40 repeat | |
IPR001680 | 296 | 335 | SM00320 | WD40 repeat | |
IPR001680 | 341 | 381 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 209 | 390 | PS50294 | WD40 repeat |
IPR001680 | 256 | 291 | PS50082 | WD40 repeat | |
IPR001680 | 303 | 337 | PS50082 | WD40 repeat | |
IPR001680 | 348 | 382 | PS50082 | WD40 repeat | |
ScanRegExp | IPR001680 | 322 | 336 | PS00678 | WD40 repeat |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CAACAGACTGATGATGCTTCG | |
: GGTTTCCGCTCTTCTTCATCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 19 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |