HUGE

Gene/Protein Characteristic Table for KIAA1938

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01186
Accession No. :	AB067525
Description :	Ras GTPase-activating protein SynGAP.
HUGO Gene Name :	synaptic Ras GTPase activating protein 1 homolog (rat) (SYNGAP1)
Clone Name :	hg00912s1 [Vector Info]
Flexi ORF Clone :	pF1KA1938
Source :	Human adult brain
Note :	We replaced hg00912, former representative clones for KIAA1938 with hg00912s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 9768 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 5635 bp

Genome contig ID gi89161210f_33396013
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CTTAAAATTTTTTAATAAACTGTGCCCTGAAACCT
Flanking genome sequence
(137285 - 137334)
----+----*----+----*----+----*----+----*----+----*
AAACTGACAGTGGACTGGATTGAGTAATTTGTGTGGGAGAGAATGTGAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 33495919 33533296 19 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1376 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96PV0	100.0	Ras GTPase-acti...	Homo sapiens
AAI48358	100.0	Synaptic Ras GT...	synthetic construct
EDL96865	99.0	synaptic Ras GT...	Rattus norvegicus
EDL96867	99.0	synaptic Ras GT...	Rattus norvegicus
XP_001256820	99.0	synaptic Ras GT...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051530	1.5e-42	49.7	KIAA1743

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 235 284 PF00169 Pleckstrin-like

IPR000008 297 377 PF00168 C2 calcium-dependent membrane targeting

IPR001936 497 668 PF00616 Ras GTPase-activating protein

HMMSmart IPR001849 60 286 SM00233 Pleckstrin-like

IPR000008 296 395 SM00239 C2 calcium-dependent membrane targeting

IPR001936 425 762 SM00323 Ras GTPase-activating protein

ProfileScan IPR001849 250 284 PS50003 Pleckstrin-like

IPR001936 476 668 PS50018 Ras GTPase-activating protein

ScanRegExp IPR001936 624 638 PS00509 Ras GTPase-activating protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	235	284	PF00169	Pleckstrin-like
IPR000008	297	377	PF00168	C2 calcium-dependent membrane targeting
IPR001936	497	668	PF00616	Ras GTPase-activating protein
HMMSmart	IPR001849	60	286	SM00233	Pleckstrin-like
IPR000008	296	395	SM00239	C2 calcium-dependent membrane targeting
IPR001936	425	762	SM00323	Ras GTPase-activating protein
ProfileScan	IPR001849	250	284	PS50003	Pleckstrin-like
IPR001936	476	668	PS50018	Ras GTPase-activating protein
ScanRegExp	IPR001936	624	638	PS00509	Ras GTPase-activating protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGACACCATCCACATTGAACC

Primer_r
: GTGAATCTCCTCCTCGTACTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGCTGAAGGCTGGAGAGTAAC
Primer_r	: CACCCCCGATTCCAGTATCTG
PCR product length	: 123 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	5635 bp
Genome contig ID	gi89161210f_33396013
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTTAAAATTTTTTAATAAACTGTGCCCTGAAACCT
Flanking genome sequence (137285 - 137334)	----+--------+--------+--------+--------+----* AAACTGACAGTGGACTGGATTGAGTAATTTGTGTGGGAGAGAATGTGAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	33495919	33533296	19	99.4	Perfect prediction

Primer_f	: AGACACCATCCACATTGAACC
Primer_r	: GTGAATCTCCTCCTCGTACTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1938

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information