HUGE |
Gene/Protein Characteristic Table for KIAA1937 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07615 |
---|---|
Accession No. : | AB067524 |
Description : | Forkhead-associated (Fragment). |
HUGO Gene Name : | forkhead-associated (FHA) phosphopeptide binding domain 1 (FHAD1) |
Clone Name : | fk04595 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3515 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1400 bp Genome contig ID gi89161185f_15440862 PolyA signal sequence
(AAGAAA,-18) +----*----+----*----+----*----+----
GCACTGGCTGAAAATGAAAGAAAACCTGCAGATTTFlanking genome sequence
(142781 - 142830) ----+----*----+----*----+----*----+----*----+----*
ACATAATCAGTCCACATGCATTATTCATGGCCTCCCTAGGCACACACAAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 15540851 15583641 16 99.8 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 704 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGCCAGGAGAAGAGGATCAAC | |
: ACTTGGCTCCTGAGGTATGAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |