HUGE |
Gene/Protein Characteristic Table for KIAA1936 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06911 |
---|---|
Accession No. : | AB067523 |
Description : | SET and MYND domain-containing protein 4. |
HUGO Gene Name : | SET and MYND domain containing 4 (SMYD4) |
Clone Name : | fk03674 [Vector Info] |
Flexi ORF Clone : | pF1KA1936
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3016 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1339 bp Genome contig ID gi51511734r_1531875 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AAATACCTGGGCGACAAGAGTGAAACTCTTGTCTCFlanking genome sequence
(99861 - 99812) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGCTTTGAGATTTGCCTCGTGTTCTCAGGATCCTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 1631736 1650849 6 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 558 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ATAGCCCAGAGCACAAATTCC | |
: TGAAGCTGTAACATGTGTCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |