HUGE

Gene/Protein Characteristic Table for KIAA1934

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01640
Accession No. :	AB067521
Description :	paraneoplastic antigen like 5.
HUGO Gene Name :	paraneoplastic antigen like 5 (PNMA5)
Clone Name :	fk02059 [Vector Info]
Flexi ORF Clone :	pF1KSDA1934
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3194 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1425 bp

Genome contig ID gi89161218r_151808027
PolyA signal sequence
(AGTAAA,-20)
+----*----+----*----+----*----+----
TTCATGTTTCTCTTCAGTAAATTTTGTTCAGTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CCAGTGGTGTCTTGCCTCTGCTGTGTGAAACTGGGGTGGGAGGTGGTCTG

Features of the protein sequence	Description

Length: 452 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96PV4	1e-177	100.0	Paraneoplastic ...	Homo sapiens
AAI01113	4.3e-177	99.8	Paraneoplastic ...	Homo sapiens
BAH14475	8.8e-177	99.6	unnamed protein...	Homo sapiens
XP_001082427	5.1e-166	94.2	similar to para...	Macaca mulatta
EDL82842	2.3e-85	58.0	rCG19945 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020690	1.4e-47	46.7	KIAA0883

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGCAGCAGGGACATTTGAAC

Primer_r
: GATGCTATTTGGTCTTGGTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1425 bp
Genome contig ID	gi89161218r_151808027
PolyA signal sequence (AGTAAA,-20)	+--------+--------+----*----+---- TTCATGTTTCTCTTCAGTAAATTTTGTTCAGTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CCAGTGGTGTCTTGCCTCTGCTGTGTGAAACTGGGGTGGGAGGTGGTCTG

Primer_f	: AGGCAGCAGGGACATTTGAAC
Primer_r	: GATGCTATTTGGTCTTGGTTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1934

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information