HUGE

Gene/Protein Characteristic Table for KIAA1932

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01639
Accession No. :	AB067519
Description :	leukocyte receptor cluster (LRC) member 8.
HUGO Gene Name :	leukocyte receptor cluster (LRC) member 8 (LENG8)
Clone Name :	fj14525 [Vector Info]
Flexi ORF Clone :	pF1KSDA1932
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3966 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 188 bp

Genome contig ID gi42406306f_59558352
PolyA signal sequence
(ATTAAA,-25)
+----*----+----*----+----*----+----
AGAAACCAAAATTAAAGAGAGAAAGAGAGAGCGTG
Flanking genome sequence
(106662 - 106711)
----+----*----+----*----+----*----+----*----+----*
CACGCTCCTGCTTTGTCTTTCCTGTGTGGGCTGTTTGCATCCATTGTCTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 59652214 59665012 16 99.6 Terminal No-hit

Features of the protein sequence	Description

Length: 795 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96PV6	0	100.0	Leukocyte recep...	Homo sapiens
XP_001174961	0	99.4	leukocyte recep...	Pan troglodytes
XP_001174966	1.3e-215	98.6	leukocyte recep...	Pan troglodytes
XP_512894	2.8e-194	89.5	leukocyte recep...	Pan troglodytes
CAQ08956	7.8e-192	93.1	leukocyte recep...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005062 545 727 PF03399 SAC3/GANP/Nin1/mts3/eIF-3 p25

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005062	545	727	PF03399	SAC3/GANP/Nin1/mts3/eIF-3 p25

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTATGGGCCACACACCTACAC

Primer_r
: GGGTGGTAACAGCAAAGGGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: CCR
Primer_f	: CTATGGGCCACACACCTACAC
Primer_r	: GGGTGGTAACAGCAAAGGGTC
PCR product length	: 134(400) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	188 bp
Genome contig ID	gi42406306f_59558352
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- AGAAACCAAAATTAAAGAGAGAAAGAGAGAGCGTG
Flanking genome sequence (106662 - 106711)	----+--------+--------+--------+--------+----* CACGCTCCTGCTTTGTCTTTCCTGTGTGGGCTGTTTGCATCCATTGTCTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	59652214	59665012	16	99.6	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1932

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information