Gene/Protein Characteristic Table for KIAA1928

Length: 5965 bp

Restriction map

The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.

Length of 3'UTR	1067 bp
Genome contig ID	gi89161185r_176064549
PolyA signal sequence (ATTAAA,-24)	+----*----+----*----+----*----+---- TGTTGATAATAATTAAACCCAGATAATTTTATAGC
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AAATGCTTGTCTCTGGCTGATTTTTACAGAGGAAGAAAGTACATTGGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	176164549	176273765	27	99.5	Perfect prediction

Length: 757 aa

This protein sequence is predicted from the revised DNA sequence

Entry Exp ID% Protein Source Q96JE7 0 99.7 Protein transpo... Homo sapiens ABN42197 0 99.7 SEC16S [Homo sa... Homo sapiens EAW91010 0 99.6 leucine zipper ... Homo sapiens EAW91015 0 99.6 leucine zipper ... Homo sapiens BAB61035 0 99.6 RGPR-p117 [Homo... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% HUGE_ID AB002308 7.5e-41 36.3 KIAA0310

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR006162	355	370	PS00012	Phosphopantetheine attachment site

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-