| HUGE |
Gene/Protein Characteristic Table for KIAA1927 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01185 |
|---|---|
| Accession No. : | AB067514 |
| Description : | Sperm-specific antigen 2. |
| HUGO Gene Name : | |
| Clone Name : | hj03131 [Vector Info] |
| Flexi ORF Clone : | pF1KA1927
![]() |
| Source : | Human adult brain |
| Note : | We replaced ah01387, former representative clones for KIAA1927 with hj03131. (2003/8/28) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5167 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1188 bp Genome contig ID gi89161199f_182364915 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
ATATATATTAAAACAATAAAGTATTTATTTTGCCTFlanking genome sequence
(138794 - 138843) ----+----*----+----*----+----*----+----*----+----*
AAAGTGTTTTAGTGGTTTCTTAAACTGCAACATGAAGATTTTGAATTAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 182464840 182503707 18 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1325 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GCAAGTCAGCATTCCGATAGC | |
| : TAACTGTTGTCTCACTGTCAC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 2 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |