HUGE

Gene/Protein Characteristic Table for KIAA1911

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00947
Accession No. :	AB067498
Description :	N-acetyltransferase ESCO1.
HUGO Gene Name :	establishment of cohesion 1 homolog 1 (S. cerevisiae) (ESCO1)
Clone Name :	fj02022 [Vector Info]
Flexi ORF Clone :	pF1KSDA1911
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4435 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1042 bp

Genome contig ID gi51511735r_17263260
PolyA signal sequence
(AATAAA,-30)
+----*----+----*----+----*----+----
AAAATAATAAAATACTTGATAGCTTTTTCTAAGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCAATGTACTAACTGAGAATAATGGTGTGTTGTCATTTGTGCTTTTTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 r 17363260 17434627 12 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 864 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10178	100.0	N-acetyltransfe...	synthetic construct
Q5FWF5	99.9	N-acetyltransfe...	Homo sapiens
AAH89426	99.8	Establishment o...	Homo sapiens
XP_523883	99.2	establishment o...	Pan troglodytes
XP_001091733	96.2	similar to esta...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCTGAAGACCCAAAGTATGC

Primer_r
: ATGTTCCGCAATTAGGCAGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1042 bp
Genome contig ID	gi51511735r_17263260
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- AAAATAATAAAATACTTGATAGCTTTTTCTAAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCAATGTACTAACTGAGAATAATGGTGTGTTGTCATTTGTGCTTTTTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	r	17363260	17434627	12	99.5	Perfect prediction

Primer_f	: TCCTGAAGACCCAAAGTATGC
Primer_r	: ATGTTCCGCAATTAGGCAGCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1911

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information