HUGE

Gene/Protein Characteristic Table for KIAA1895

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00943
Accession No. :	AB067482
Description :	Protein FAM111A.
HUGO Gene Name :	family with sequence similarity 111, member A (FAM111A)
Clone Name :	fk05638 [Vector Info]
Flexi ORF Clone :	pF1KSDA1895
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3992 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1528 bp

Genome contig ID gi51511727f_58572294
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
TGTTTGTAAGTTCCTATTAAATGTTTCTTTCTGAG
Flanking genome sequence
(106793 - 106842)
----+----*----+----*----+----*----+----*----+----*
AAACCGTATTTGTCAGCCTCTTTCTTTGGCCTCTCAGCTTCTTTGGTCTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 58672294 58679085 2 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 628 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96PZ2	0	100.0	Protein FAM111A.	Homo sapiens
AAH71759	0	99.8	FAM111A protein...	Homo sapiens
XP_001090771	0	89.7	hypothetical pr...	Macaca mulatta
AAH13137	2.1e-175	100.0	FAM111A protein...	Homo sapiens
XP_852330	1e-143	62.7	hypothetical pr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTACAGTGCAGGAACCAAAAC

Primer_r
: AAGACCCATATATTCCGACAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1528 bp
Genome contig ID	gi51511727f_58572294
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TGTTTGTAAGTTCCTATTAAATGTTTCTTTCTGAG
Flanking genome sequence (106793 - 106842)	----+--------+--------+--------+--------+----* AAACCGTATTTGTCAGCCTCTTTCTTTGGCCTCTCAGCTTCTTTGGTCTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	58672294	58679085	2	99.2	Perfect prediction

Primer_f	: CTACAGTGCAGGAACCAAAAC
Primer_r	: AAGACCCATATATTCCGACAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1895

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information