HUGE

Gene/Protein Characteristic Table for KIAA1872

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00938
Accession No. :	AB058775
Description :	Caytaxin.
HUGO Gene Name :
Clone Name :	hj05518 [Vector Info]
Flexi ORF Clone :	pF1KSDA1872
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4976 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3484 bp

Genome contig ID gi42406306f_3731672
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GGGGACTTTTATGTGGAATAAAGAAACTATCACTG
Flanking genome sequence
(147406 - 147455)
----+----*----+----*----+----*----+----*----+----*
AGAAGGGAGGTTTGTTCCTTTTGAGTACTAGTAACAGGCAGGGCCCAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 3831672 3879076 13 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 434 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86WG3	4.6e-154	100.0	Caytaxin; Ataxi...	Homo sapiens
AAO63019	2.1e-153	99.7	BNIP-H [Homo sa...	Homo sapiens
CAH90150	1.7e-152	98.9	hypothetical pr...	Pongo abelii
Q9GKT0	5.8e-152	98.4	Caytaxin.	Macaca fascicularis
AAI33610	1.9e-145	94.6	ATCAY protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002365	1.3e-52	61.6	KIAA0367

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR001251 234 388 SM00516 Cellular retinaldehyde-binding/triple function

ProfileScan IPR001251 234 391 PS50191 Cellular retinaldehyde-binding/triple function

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001251	234	388	SM00516	Cellular retinaldehyde-binding/triple function
ProfileScan	IPR001251	234	391	PS50191	Cellular retinaldehyde-binding/triple function

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATAGACCTGCACATGATCCGG

Primer_r
: TCTAAGCTGCTGATGACGTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CGAAACTGAAGACCCCAACTC
Primer_r	: ATCCATCTCAAAGCCCATCTG
PCR product length	: 95 bp
PCR conditions	: 15 °C64 sec60 °C30 sec161 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3484 bp
Genome contig ID	gi42406306f_3731672
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GGGGACTTTTATGTGGAATAAAGAAACTATCACTG
Flanking genome sequence (147406 - 147455)	----+--------+--------+--------+--------+----* AGAAGGGAGGTTTGTTCCTTTTGAGTACTAGTAACAGGCAGGGCCCAGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	3831672	3879076	13	99.3	Perfect prediction

Primer_f	: ATAGACCTGCACATGATCCGG
Primer_r	: TCTAAGCTGCTGATGACGTAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1872

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information