| HUGE |
Gene/Protein Characteristic Table for KIAA1864 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05476 |
|---|---|
| Accession No. : | AB058767 |
| Description : | Hydrocephalus-inducing protein homolog. |
| HUGO Gene Name : | |
| Clone Name : | fj07836 [Vector Info] |
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4599 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 909 bp Genome contig ID gi51511732r_69385229 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ACTCCAGCCTCAGCAACAGAGCGAGACCCTGTCTCFlanking genome sequence
(99711 - 99662) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAGAAAAGAAAAGAAAAGAAAAAGTAACACAAAATCAGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 r 69484940 69565334 20 99.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 660 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : TCGGTTGGAGGTTTTAGATGC | |
| : CGCGATCTCATATTTCCCACG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : "1,16" |
| : CCR | |
| : ACAGACCTGGACAACTTCAAC | |
| : GTATGGGTAAGTGCAGATGCC | |
| : 95 bp | |
| : 15 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |