HUGE

Gene/Protein Characteristic Table for KIAA1862

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00936
Accession No. :	AB058765
Description :	KRAB-A domain containing 1 (KRBA1), mRNA.
HUGO Gene Name :	KRAB-A domain containing 1 (KRBA1)
Clone Name :	aj00563 [Vector Info]
Flexi ORF Clone :	pF1KSDA1862
Source :	Human brain (amygdala)
Note :	We replaced fh24543, former representative clones for KIAA1862 with aj00563. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4018 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 526 bp

Genome contig ID gi89161213f_148943081
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
GTGGATTCTGAAATTAAAGAAGTGAGTTGCTAAGG
Flanking genome sequence
(119516 - 119565)
----+----*----+----*----+----*----+----*----+----*
AAGGCCCTGACTCCTATAGAAGGGAGGTCCATGTGGGCCCACGCTGGGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 149043081 149062595 17 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1070 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_115923	0	99.9	KRAB A domain c...	Homo sapiens
AAI42723	0	99.9	KRBA1 protein [...	Homo sapiens
AAH33229	2.1e-135	91.6	KRBA1 protein [...	Homo sapiens
XP_590551	9.5e-62	57.1	similar to RIKE...	Bos taurus
EDK98525	2.6e-48	53.5	RIKEN cDNA A930...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001909 12 52 PF01352 KRAB box

HMMSmart IPR001909 12 74 SM00349 KRAB box

ProfileScan IPR001909 12 90 PS50805 KRAB box

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001909	12	52	PF01352	KRAB box
HMMSmart	IPR001909	12	74	SM00349	KRAB box
ProfileScan	IPR001909	12	90	PS50805	KRAB box

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTTCCTGGAGTAAATATTGG

Primer_r
: ACATGGACCTCCCTTCTATAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	526 bp
Genome contig ID	gi89161213f_148943081
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- GTGGATTCTGAAATTAAAGAAGTGAGTTGCTAAGG
Flanking genome sequence (119516 - 119565)	----+--------+--------+--------+--------+----* AAGGCCCTGACTCCTATAGAAGGGAGGTCCATGTGGGCCCACGCTGGGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	149043081	149062595	17	99.9	Perfect prediction

Primer_f	: CCTTCCTGGAGTAAATATTGG
Primer_r	: ACATGGACCTCCCTTCTATAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1862

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information