HUGE

Gene/Protein Characteristic Table for KIAA1861

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00289
Accession No. :	AB058764
Description :	coiled-coil domain containing 132 isoform a.
HUGO Gene Name :	coiled-coil domain containing 132 (CCDC132)
Clone Name :	fk12955 [Vector Info]
Flexi ORF Clone :	pF1KA1861
Source :	Human fetal brain
Note :	We replaced fh20701, former representative clones for KIAA1861 with fk12955. (2001/6/05)

Features of the cloned DNA sequence	Description

Length: 3558 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 589 bp

Genome contig ID gi89161213f_92599644
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
GAAATTTAATAAATATACTCTAGTATGATCAGCCT
Flanking genome sequence
(226631 - 226680)
----+----*----+----*----+----*----+----*----+----*
ATGTGAGACTACATTTTGATTTTTTGTGTGGCATGCAGATGTCATGAACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 92699644 92826273 28 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 979 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96JG6	99.9	Coiled-coil dom...	Homo sapiens
AAI52425	100.0	CCDC132 protein...	Homo sapiens
XP_001492692	98.5	coiled-coil dom...	Equus caballus
XP_519203	98.8	hypothetical pr...	Pan troglodytes
XP_532460	97.1	similar to CG49...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAATGATGTTGCCGCCTTGTC

Primer_r
: CTCAGAGGGTAGAAAAGTGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	589 bp
Genome contig ID	gi89161213f_92599644
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- GAAATTTAATAAATATACTCTAGTATGATCAGCCT
Flanking genome sequence (226631 - 226680)	----+--------+--------+--------+--------+----* ATGTGAGACTACATTTTGATTTTTTGTGTGGCATGCAGATGTCATGAACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	92699644	92826273	28	100.0	Perfect prediction

Primer_f	: AAATGATGTTGCCGCCTTGTC
Primer_r	: CTCAGAGGGTAGAAAAGTGCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1861

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information