HUGE

Gene/Protein Characteristic Table for KIAA1844

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07345
Accession No. :	AB058747
Description :	WW domain-containing adapter protein with coiled-coil.
HUGO Gene Name :
Clone Name :	fj12009 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4526 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3420 bp

Genome contig ID gi89161187f_28764621
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTACATGTAAACCTGTCTGCAAAATTAGCTTTTTT
Flanking genome sequence
(184276 - 184325)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAATTGGGGGGGTTAATTTATCATTCAGAAATCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 28864621 28948895 10 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 367 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW86036	3.8e-107	100.0	WW domain conta...	Homo sapiens
CAD28517	5.2e-104	98.4	hypothetical pr...	Homo sapiens
CAH70768	1.8e-103	99.2	WW domain conta...	Homo sapiens
Q9BTA9	1.9e-103	99.2	WW domain-conta...	Homo sapiens
BAD97320	1.9e-103	99.2	WW domain-conta...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001202 63 92 PF00397 WW/Rsp5/WWP

HMMSmart IPR001202 62 94 SM00456 WW/Rsp5/WWP

ProfileScan IPR001202 67 94 PS50020 WW/Rsp5/WWP

ScanRegExp IPR001202 67 92 PS01159 WW/Rsp5/WWP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	63	92	PF00397	WW/Rsp5/WWP
HMMSmart	IPR001202	62	94	SM00456	WW/Rsp5/WWP
ProfileScan	IPR001202	67	94	PS50020	WW/Rsp5/WWP
ScanRegExp	IPR001202	67	92	PS01159	WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGTAAATCTGTTGCCCAATC

Primer_r
: CGTGAAGGATACATCTACAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3420 bp
Genome contig ID	gi89161187f_28764621
PolyA signal sequence (None)	+--------+--------+----*----+---- TTACATGTAAACCTGTCTGCAAAATTAGCTTTTTT
Flanking genome sequence (184276 - 184325)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAATTGGGGGGGTTAATTTATCATTCAGAAATCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	28864621	28948895	10	100.0	Perfect prediction

Primer_f	: CTGTAAATCTGTTGCCCAATC
Primer_r	: CGTGAAGGATACATCTACAAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1844

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information