HUGE |
Gene/Protein Characteristic Table for KIAA1831 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00929 |
---|---|
Accession No. : | AB058734 |
Description : | Junctophilin-4. |
HUGO Gene Name : | junctophilin 4 (JPH4) |
Clone Name : | hk00543 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1831
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4278 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1599 bp Genome contig ID gi51511730r_23007144 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
AAAAAAATATATTAATAAAAAAGTTCAAAAAAGGGFlanking genome sequence
(99940 - 99891) ----+----*----+----*----+----*----+----*----+----*
GGGGGATTGTCATCTCCTTTGGGGTGCGATGGCTTCAAATCCAAACTGAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 r 23107084 23117849 6 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 663 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003409 | 50 | 72 | PF02493 | MORN motif |
IPR003409 | 74 | 95 | PF02493 | MORN motif | |
IPR003409 | 96 | 117 | PF02493 | MORN motif | |
IPR003409 | 118 | 140 | PF02493 | MORN motif | |
IPR003409 | 141 | 163 | PF02493 | MORN motif | |
IPR003409 | 164 | 186 | PF02493 | MORN motif | |
IPR003409 | 317 | 339 | PF02493 | MORN motif | |
IPR003409 | 340 | 362 | PF02493 | MORN motif | |
HMMSmart | IPR003409 | 48 | 69 | SM00698 | MORN motif |
IPR003409 | 94 | 115 | SM00698 | MORN motif | |
IPR003409 | 139 | 160 | SM00698 | MORN motif | |
IPR003409 | 162 | 183 | SM00698 | MORN motif | |
IPR003409 | 315 | 336 | SM00698 | MORN motif | |
IPR003409 | 338 | 359 | SM00698 | MORN motif |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 639 | ANPLVVGAVALLDLSLAFLFSQL | 661 | PRIMARY | 23 |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TAGGACCAGACAAGATAACAG | |
: TTTGATCCCCTCCTTCTGTTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 14 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |