HUGE

Gene/Protein Characteristic Table for KIAA1823

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00927
Accession No. :	AB058726
Description :	PHD finger protein 6.
HUGO Gene Name :	PHD finger protein 6 (PHF6)
Clone Name :	fj18328 [Vector Info]
Flexi ORF Clone :	pF1KSDA1823
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4315 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3129 bp

Genome contig ID gi89161218f_133235122
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TATACTATTCATTCAATAAATGACTTATGACTTTC
Flanking genome sequence
(155365 - 155414)
----+----*----+----*----+----*----+----*----+----*
ATATTTGTTTGTCTTTTTTGTGAAAGTGTATACTGAAGCTTATTTGATAA

Features of the protein sequence	Description

Length: 377 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8IWS0	1.2e-150	100.0	PHD finger prot...	Homo sapiens
Q08DR0	2.2e-150	99.7	PHD finger prot...	Bos taurus
XP_852628	2.2e-150	99.7	similar to PHD ...	Canis lupus fam...
XP_866100	1.2e-149	99.5	similar to PHD ...	Canis lupus fam...
XP_001927436	1.7e-149	99.5	similar to PHD ...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037754	1.8e-09	31.4	KIAA1333
AB002302	3.9e-05	25.0	KIAA0304

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR001965 93 144 SM00249 Zinc finger

IPR001965 291 342 SM00249 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001965	93	144	SM00249	Zinc finger
IPR001965	291	342	SM00249	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGTTGGCTAGATAAGTGGCTG

Primer_r
: CTACCCAGAAGATGATGATGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3129 bp
Genome contig ID	gi89161218f_133235122
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TATACTATTCATTCAATAAATGACTTATGACTTTC
Flanking genome sequence (155365 - 155414)	----+--------+--------+--------+--------+----* ATATTTGTTTGTCTTTTTTGTGAAAGTGTATACTGAAGCTTATTTGATAA

Primer_f	: GGTTGGCTAGATAAGTGGCTG
Primer_r	: CTACCCAGAAGATGATGATGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1823

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information