HUGE

Gene/Protein Characteristic Table for KIAA1820

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01638
Accession No. :	AB058723
Description :	Retinoic acid-induced protein 1.
HUGO Gene Name :	retinoic acid induced 1 (RAI1)
Clone Name :	hh01321 [Vector Info]
Flexi ORF Clone :	pF1KSDA1820
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5915 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 523 bp

Genome contig ID gi51511734f_17425512
PolyA signal sequence
(AGTAAA,-25)
+----*----+----*----+----*----+----
TTTCCTTAAGAGTAAAAAACAGTCATTGCATTCAG
Flanking genome sequence
(229932 - 229981)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAGTCAATAAAGATACAACGATTGTTTTGGAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 17525512 17655442 4 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 1644 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10157	100.0	retinoic acid-i...	synthetic construct
Q7Z5J4	99.9	Retinoic acid-i...	Homo sapiens
EAW55696	99.9	retinoic acid i...	Homo sapiens
AAO31738	99.8	retinoic acid i...	Homo sapiens
XP_001159372	99.3	retinoic acid i...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB006630	1.1e-13	25.3	KIAA0292

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CGCACCAAAACCCAGGAGATC

Primer_r
: CTGGAGACCTTGAATGTGGCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CGCACCAAAACCCAGGAGATC
Primer_r	: CTGGAGACCTTGAATGTGGCG
PCR product length	: 95 bp
PCR conditions	: 15 °C66 sec60 °C30 sec128 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	523 bp
Genome contig ID	gi51511734f_17425512
PolyA signal sequence (AGTAAA,-25)	+--------+--------+----*----+---- TTTCCTTAAGAGTAAAAAACAGTCATTGCATTCAG
Flanking genome sequence (229932 - 229981)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGTCAATAAAGATACAACGATTGTTTTGGAAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	17525512	17655442	4	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1820

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information