HUGE

Gene/Protein Characteristic Table for KIAA1801

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05883
Accession No. :	AB058704
Description :	leucine-rich repeats and IQ motif containing 1 isoform 2.
HUGO Gene Name :	leucine-rich repeats and IQ motif containing 1 (LRRIQ1)
Clone Name :	fj21373 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4021 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 335 bp

Genome contig ID gi89161190f_83863943
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TCACAGTCTAAAAATAATAAAAACATTTTCTGAGT
Flanking genome sequence
(178826 - 178875)
----+----*----+----*----+----*----+----*----+----*
AATCAAGTATTTTCATTTTTTAAAAATATACCTTTGCAGGCTGGGCGCGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 83963938 84042767 13 99.4 Terminal No-hit

Features of the protein sequence	Description

Length: 1227 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96JM4	0	99.9	Leucine-rich re...	Homo sapiens
EAW97395	0	99.8	leucine-rich re...	Homo sapiens
NP_001073379	0	99.8	leucine-rich re...	Homo sapiens
EAW97396	0	97.9	leucine-rich re...	Homo sapiens
XP_001478078	2.9e-181	54.9	eucine-rich rep...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 884 897 PR00019 Leucine-rich repeat

IPR001611 971 984 PR00019 Leucine-rich repeat

HMMPfam IPR000048 175 195 PF00612 IQ calmodulin-binding region

IPR001611 710 730 PF00560 Leucine-rich repeat

IPR001611 883 903 PF00560 Leucine-rich repeat

IPR001611 905 925 PF00560 Leucine-rich repeat

IPR001611 927 947 PF00560 Leucine-rich repeat

IPR001611 973 997 PF00560 Leucine-rich repeat

HMMSmart IPR003591 751 773 SM00369 Leucine-rich repeat

IPR003591 859 881 SM00369 Leucine-rich repeat

IPR003591 925 946 SM00369 Leucine-rich repeat

IPR003591 971 994 SM00369 Leucine-rich repeat

ProfileScan IPR000048 174 203 PS50096 IQ calmodulin-binding region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	884	897	PR00019	Leucine-rich repeat
IPR001611	971	984	PR00019	Leucine-rich repeat
HMMPfam	IPR000048	175	195	PF00612	IQ calmodulin-binding region
IPR001611	710	730	PF00560	Leucine-rich repeat
IPR001611	883	903	PF00560	Leucine-rich repeat
IPR001611	905	925	PF00560	Leucine-rich repeat
IPR001611	927	947	PF00560	Leucine-rich repeat
IPR001611	973	997	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	751	773	SM00369	Leucine-rich repeat
IPR003591	859	881	SM00369	Leucine-rich repeat
IPR003591	925	946	SM00369	Leucine-rich repeat
IPR003591	971	994	SM00369	Leucine-rich repeat
ProfileScan	IPR000048	174	203	PS50096	IQ calmodulin-binding region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTTCTACTCTTGTGCACGTG

Primer_r
: GGAATACTGCTTGCCTTGCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	335 bp
Genome contig ID	gi89161190f_83863943
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TCACAGTCTAAAAATAATAAAAACATTTTCTGAGT
Flanking genome sequence (178826 - 178875)	----+--------+--------+--------+--------+----* AATCAAGTATTTTCATTTTTTAAAAATATACCTTTGCAGGCTGGGCGCGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	83963938	84042767	13	99.4	Terminal No-hit

Primer_f	: TCTTCTACTCTTGTGCACGTG
Primer_r	: GGAATACTGCTTGCCTTGCTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1801

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information