| HUGE |
Gene/Protein Characteristic Table for KIAA1801 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05883 |
|---|---|
| Accession No. : | AB058704 |
| Description : | leucine-rich repeats and IQ motif containing 1 isoform 2. |
| HUGO Gene Name : | leucine-rich repeats and IQ motif containing 1 (LRRIQ1) |
| Clone Name : | fj21373 [Vector Info] |
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4021 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 335 bp Genome contig ID gi89161190f_83863943 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TCACAGTCTAAAAATAATAAAAACATTTTCTGAGTFlanking genome sequence
(178826 - 178875) ----+----*----+----*----+----*----+----*----+----*
AATCAAGTATTTTCATTTTTTAAAAATATACCTTTGCAGGCTGGGCGCGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 83963938 84042767 13 99.4 Terminal No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1227 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : TCTTCTACTCTTGTGCACGTG | |
| : GGAATACTGCTTGCCTTGCTG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 12 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |