HUGE

Gene/Protein Characteristic Table for KIAA1792

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00920
Accession No. :	AB058695
Description :	FAST kinase domain-containing protein 5.
HUGO Gene Name :
Clone Name :	fh27316 [Vector Info]
Flexi ORF Clone :	pF1KSDA1792
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5223 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 251 bp

Genome contig ID gi51511747r_2975171
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
AGTAAATAATAAACATCTTAATATGTCCTACGGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTAAGTCCTTGTTGGATTTTTCTTTCTGTTTACCAGCCTTATGTCACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 3075171 3080393 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 808 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7L8L6	100.0	FAST kinase dom...	Homo sapiens
Q5RFI6	95.3	FAST kinase dom...	Pongo abelii
CAH92792	95.0	hypothetical pr...	Pongo abelii
Q95KD0	94.6	FAST kinase dom...	Macaca fascicularis
XP_001915879	82.2	FAST kinase dom...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058703	7.2e-08	20.9	KIAA1800

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010622 474 546 PF06743 FAST kinase leucine-rich

IPR013579 553 646 PF08368 FAST kinase-like protein

IPR013584 743 802 PF08373 RAP domain

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010622	474	546	PF06743	FAST kinase leucine-rich
IPR013579	553	646	PF08368	FAST kinase-like protein
IPR013584	743	802	PF08373	RAP domain

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTCTCTGAAGGGCATTTAGGG

Primer_r
: GCTCTAACCTGCCTTGGATAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	251 bp
Genome contig ID	gi51511747r_2975171
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AGTAAATAATAAACATCTTAATATGTCCTACGGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTAAGTCCTTGTTGGATTTTTCTTTCTGTTTACCAGCCTTATGTCACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	3075171	3080393	1	99.0	Perfect prediction

Primer_f	: CTCTCTGAAGGGCATTTAGGG
Primer_r	: GCTCTAACCTGCCTTGGATAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1792

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information