HUGE

Gene/Protein Characteristic Table for KIAA1789

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07429
Accession No. :	AB058692
Description :	zinc finger, matrin type 1 isoform 1.
HUGO Gene Name :	zinc finger, matrin type 1 (ZMAT1)
Clone Name :	fh23186 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5751 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 851 bp

Genome contig ID gi89161218r_100924286
PolyA signal sequence
(AATGAA,-28)
+----*----+----*----+----*----+----
TTCCCTAAATGAAGTTGTCTCTACTTCTGCTCATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATTGCTGTGATAGTGAATTATTTATTCATGGGAGATAATTTATTTTAA

Features of the protein sequence	Description

Length: 477 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5H9K5	4.8e-165	99.8	Zinc finger mat...	Homo sapiens
AAI52471	1.7e-164	100.0	Zinc finger, ma...	Homo sapiens
EAX02897	3.7e-164	99.8	hCG17853 [Homo ...	Homo sapiens
XP_001140711	5.1e-163	99.4	zinc finger, ma...	Pan troglodytes
XP_001096018	2e-158	96.4	similar to zinc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 14 38 PF00096 Zinc finger

HMMSmart IPR015880 14 38 SM00355 Zinc finger

ScanRegExp IPR007087 16 38 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	14	38	PF00096	Zinc finger
HMMSmart	IPR015880	14	38	SM00355	Zinc finger
ScanRegExp	IPR007087	16	38	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGGTCAAAGATAAGTGGAAGG

Primer_r
: AAGGAGAGAGGTTCAGTGAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	851 bp
Genome contig ID	gi89161218r_100924286
PolyA signal sequence (AATGAA,-28)	+--------+--------+----*----+---- TTCCCTAAATGAAGTTGTCTCTACTTCTGCTCATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATTGCTGTGATAGTGAATTATTTATTCATGGGAGATAATTTATTTTAA

Primer_f	: TGGTCAAAGATAAGTGGAAGG
Primer_r	: AAGGAGAGAGGTTCAGTGAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1789

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information