HUGE

Gene/Protein Characteristic Table for KIAA1771

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB051558
Description :	Dedicator of cytokinesis protein 7.
HUGO Gene Name :	dedicator of cytokinesis 7 (DOCK7)
Clone Name :	pj02581 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 4420 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 401 bp

Genome contig ID gi89161185r_62593272
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
TTAAAGGTACTATTAAATATGTGAATGTTTACACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTTTACCGAGTGGGACTTCAAAATTTTTATTATTGACAATGGCAGAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 62693272 62794193 29 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1302 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_524725	99.9	dedicator of cy...	Pan troglodytes
EAX06584	99.7	hCG24180 [Homo ...	Homo sapiens
ABC68221	99.7	dedicator of cy...	Homo sapiens
Q8R1A4	98.2	Dedicator of cy...	Mus musculus
EDL30893	97.9	dedicator of cy...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037816	0	66.3	KIAA1395
AB028981	4.3e-33	31.7	KIAA1058
AB002297	1.3e-09	23.9	KIAA0299
AB018259	2.7e-08	24.3	KIAA0716

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010703 1092 1271 PF06920 Dedicator of cytokinesis

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010703	1092	1271	PF06920	Dedicator of cytokinesis

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAATGCTTCAGATGGTACTCC

Primer_r
: TGATCCGGCCCAATTAAGCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	401 bp
Genome contig ID	gi89161185r_62593272
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TTAAAGGTACTATTAAATATGTGAATGTTTACACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTTACCGAGTGGGACTTCAAAATTTTTATTATTGACAATGGCAGAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	62693272	62794193	29	99.8	Perfect prediction

Primer_f	: AAATGCTTCAGATGGTACTCC
Primer_r	: TGATCCGGCCCAATTAAGCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1771

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information