HUGE

Gene/Protein Characteristic Table for KIAA0716

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04821
Accession No. :	AB018259
Description :	Dedicator of cytokinesis protein 4.
HUGO Gene Name :	dedicator of cytokinesis 4 (DOCK4)
Clone Name :	ah04178 [Vector Info]
Source :	Human brain (amygdala)
Note :	We replaced hj03473, former representative clones for KIAA0716 with ah04178. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 6325 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2156 bp

Genome contig ID gi89161213r_111053410
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GCTGAATGGTAAATATTAAATAAAATTACCAGATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATCTTAATATTTCTGTCTTTACTCCTATCATCAGCATGTCTTTACTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 111153410 111304420 36 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1388 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI41139	98.1	Dock4 protein [...	Mus musculus
P59764	95.4	Dedicator of cy...	Mus musculus
XP_539524	93.4	similar to Dedi...	Canis lupus fam...
XP_001167034	95.9	dedicator of cy...	Pan troglodytes
XP_001167212	94.7	dedicator of cy...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002297	1.2e-125	56.6	KIAA0299
D86964	3.3e-49	37.8	KIAA0209

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AATTTTGGCAGTGAGCAGTTG

Primer_r
: ATTTACCATTCAGCAGCAACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AATTTTGGCAGTGAGCAGTTG
Primer_r	: ATTTACCATTCAGCAGCAACC
PCR product length	: 134 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2156 bp
Genome contig ID	gi89161213r_111053410
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GCTGAATGGTAAATATTAAATAAAATTACCAGATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCTTAATATTTCTGTCTTTACTCCTATCATCAGCATGTCTTTACTTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	111153410	111304420	36	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0716

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information