HUGE |
Gene/Protein Characteristic Table for KIAA1768 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB051555 |
Description : | kinase non-catalytic C-lobe domain (KIND) containing 1 isoform a. |
HUGO Gene Name : | kinase non-catalytic C-lobe domain (KIND) containing 1 (KNDC1) |
Clone Name : | ph00672 [Vector Info] |
Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5514 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | Warning for N-terminal truncation: NO | NO | Warning for coding interruption: YES | NO | |
Length of 3'UTR 209 bp Genome contig ID gi89161187f_134730678 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TGCACCCTCCCAGTGATCGTGAACATCGCGGCCGCFlanking genome sequence
(140022 - 140071) ----+----*----+----*----+----*----+----*----+----*
ACCCTGCGACACGCTGGACTTCAGCCCCCTGGACGAGTCCTCCTCGCTCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 134830678 134870698 18 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1207 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTTCGATGGCTACCTGGACAA | |
: TGCCCGTTGACCACCTTAAAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 10 |
: CCR | |
: CTTCGATGGCTACCTGGACAA | |
: TGCCCGTTGACCACCTTAAAG | |
: 171(350) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |