| HUGE |
Gene/Protein Characteristic Table for KIAA1753 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00911 |
|---|---|
| Accession No. : | AB051540 |
| Description : | Zinc finger CCCH domain-containing protein 5. |
| HUGO Gene Name : | unkempt homolog (Drosophila) (UNK) |
| Clone Name : | pj02614 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1753
|
| Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3839 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1381 bp Genome contig ID gi51511734f_71192532 PolyA signal sequence
(AATAAA,-18)
GCTCCAAACCTATTGGAAATAAAATATGAACTTGCFlanking genome sequence
(140944 - 140993)
AGTGGTAGCTTGTTTACATGGGGGTGAGGGGGAGTGGGTCCCAAAAGAGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 71292532 71333474 16 99.9 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 818 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : CCGGAAGCACAAATACAGGTC | |
| : CTTGGTGGACTTGTAGATCTC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 17 |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
