HUGE

Gene/Protein Characteristic Table for KIAA1737

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00907
Accession No. :	AB051524
Description :
HUGO Gene Name :
Clone Name :	pj00125 [Vector Info]
Flexi ORF Clone :	pF1KSDA1737
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 4221 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2967 bp

Genome contig ID gi51511730f_76541751
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
GTCAGAGAAAAATAAAAGTCACTTACTTGAAACCT
Flanking genome sequence
(111633 - 111682)
----+----*----+----*----+----*----+----*----+----*
ATTTGGCCTTTTTGCTTTATAACTGCTTAAAAATACTGAGTGAACCTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 76641751 76653382 3 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 400 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
ABV48911	1.1e-112	86.7	clock interacti...	Ovis aries
AAH26384	7.2e-111	86.0	RIKEN cDNA 2310...	Mus musculus
BAE28540	7.7e-111	86.0	unnamed protein...	Mus musculus
EDL02913	7.7e-111	86.0	RIKEN cDNA 2310...	Mus musculus
BAE32612	1.4e-110	85.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTACCATGGGCATTTGTTCTC

Primer_r
: ATCTTTCTGGTCACCTCCGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2967 bp
Genome contig ID	gi51511730f_76541751
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTCAGAGAAAAATAAAAGTCACTTACTTGAAACCT
Flanking genome sequence (111633 - 111682)	----+--------+--------+--------+--------+----* ATTTGGCCTTTTTGCTTTATAACTGCTTAAAAATACTGAGTGAACCTGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	76641751	76653382	3	99.1	Perfect prediction

Primer_f	: TTACCATGGGCATTTGTTCTC
Primer_r	: ATCTTTCTGGTCACCTCCGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1737

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information