HUGE

Gene/Protein Characteristic Table for KIAA1735

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00905
Accession No. :	AB051522
Description :	Dixin.
HUGO Gene Name :	DIX domain containing 1 (DIXDC1)
Clone Name :	ph00512 [Vector Info]
Flexi ORF Clone :	pF1KSDA1735
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 4732 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2943 bp

Genome contig ID gi51511727f_111253336
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCTAGCCTAGGCTACAGAGCAGGACCCCATCTCC
Flanking genome sequence
(144579 - 144628)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAGTCATTTAAAAACTGAAGAATGTTCTCTTCTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 111353336 111397913 16 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 493 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH33034	3e-157	100.0	DIX domain cont...	Homo sapiens
BAF82496	4.3e-157	99.8	unnamed protein...	Homo sapiens
XP_001145139	3.9e-156	99.2	DIX domain cont...	Pan troglodytes
XP_001106878	1.1e-154	98.1	similar to DIX ...	Macaca mulatta
ABG25914	4.8e-154	98.7	DIX domain cont...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001158 411 486 PD003639 DIX

HMMPfam IPR001158 408 490 PF00778 DIX

HMMSmart IPR001158 408 490 SM00021 DIX

ProfileScan IPR001158 410 490 PS50841 DIX

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001158	411	486	PD003639	DIX
HMMPfam	IPR001158	408	490	PF00778	DIX
HMMSmart	IPR001158	408	490	SM00021	DIX
ProfileScan	IPR001158	410	490	PS50841	DIX

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCACAATAGAAACCATGGGGC

Primer_r
: CTGACTGGTTGATGGTGCTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2943 bp
Genome contig ID	gi51511727f_111253336
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCTAGCCTAGGCTACAGAGCAGGACCCCATCTCC
Flanking genome sequence (144579 - 144628)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGTCATTTAAAAACTGAAGAATGTTCTCTTCTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	111353336	111397913	16	99.9	Perfect prediction

Primer_f	: GCACAATAGAAACCATGGGGC
Primer_r	: CTGACTGGTTGATGGTGCTTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1735

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information