HUGE

Gene/Protein Characteristic Table for KIAA1732

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06787
Accession No. :	AB051519
Description :	Histone-lysine N-methyltransferase SETD2.
HUGO Gene Name :	SET domain containing 2 (SETD2)
Clone Name :	bg00050 [Vector Info]
Flexi ORF Clone :	pF1KA1732
Source :	Human adult brain
Note :	We replaced ph00196, former representative clones for KIAA1732 with bg00050. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6403 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 655 bp

Genome contig ID gi89161205r_46932932
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GAACTTTTTATGTAAAAAAATAAAATCAATTAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTTGGCATGTGTGTTCCCTAAAAGTTAATCAAGCATATTTGTGTGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 47032932 47139182 19 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1915 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI17163	100.0	SET domain cont...	Homo sapiens
EAW64810	100.0	SET domain cont...	Homo sapiens
NP_054878	99.9	SET domain cont...	Homo sapiens
CAC28349	99.8	huntingtin inte...	Homo sapiens
Q9BYW2	99.8	Histone-lysine ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029013	7.2e-16	40.3	KIAA1090
AB002386	5.3e-05	31.6	KIAA0388
AB028999	0.00019	31.0	KIAA1076
AB002337	0.00076	32.8	KIAA0339
AB002302	0.00079	32.9	KIAA0304

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001214 895 1024 PF00856 SET

IPR001202 1742 1771 PF00397 WW/Rsp5/WWP

IPR015119 1810 1906 PF09031 Set2-Rpb1 interacting

HMMSmart IPR006560 845 900 SM00570 AWS

IPR001214 901 1024 SM00317 SET

IPR003616 1025 1041 SM00508 Post-SET zinc-binding region

IPR001202 1741 1773 SM00456 WW/Rsp5/WWP

ProfileScan IPR006560 845 899 PS51215 AWS

IPR001214 900 1022 PS50280 SET

IPR003616 1025 1041 PS50868 Post-SET zinc-binding region

IPR001202 1740 1773 PS50020 WW/Rsp5/WWP

ScanRegExp IPR001202 1746 1771 PS01159 WW/Rsp5/WWP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001214	895	1024	PF00856	SET
IPR001202	1742	1771	PF00397	WW/Rsp5/WWP
IPR015119	1810	1906	PF09031	Set2-Rpb1 interacting
HMMSmart	IPR006560	845	900	SM00570	AWS
IPR001214	901	1024	SM00317	SET
IPR003616	1025	1041	SM00508	Post-SET zinc-binding region
IPR001202	1741	1773	SM00456	WW/Rsp5/WWP
ProfileScan	IPR006560	845	899	PS51215	AWS
IPR001214	900	1022	PS50280	SET
IPR003616	1025	1041	PS50868	Post-SET zinc-binding region
IPR001202	1740	1773	PS50020	WW/Rsp5/WWP
ScanRegExp	IPR001202	1746	1771	PS01159	WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAGTTGTGAGCTGTTGGCATG

Primer_r
: ACAGATCATCAGGGTAAAGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

Experimental conditions

Panel name	:
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	655 bp
Genome contig ID	gi89161205r_46932932
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GAACTTTTTATGTAAAAAAATAAAATCAATTAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTTGGCATGTGTGTTCCCTAAAAGTTAATCAAGCATATTTGTGTGTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	47032932	47139182	19	99.4	Perfect prediction

Primer_f	: TAGTTGTGAGCTGTTGGCATG
Primer_r	: ACAGATCATCAGGGTAAAGGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1732

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information