HUGE

Gene/Protein Characteristic Table for KIAA1720

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00899
Accession No. :	AB051507
Description :	SH3-binding domain protein 5-like.
HUGO Gene Name :	SH3-binding domain protein 5-like (SH3BP5L)
Clone Name :	pf00447 [Vector Info]
Flexi ORF Clone :	pF1KSDA1720
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 2893 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1452 bp

Genome contig ID gi89161185r_246971270
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
GGTTTTATTTAAATAAAGTAGTTTATGTAACAGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACATCTACTGTCCTTGCTGGAGGAAGAGAAAAGGGGCAAAGATGAGGCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 247071270 247086016 6 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 421 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q7L8J4	5.6e-132	100.0	SH3 domain-bind...	Homo sapiens
XP_001107738	3.7e-131	99.2	similar to SH3-...	Macaca mulatta
Q5R9X9	6.6e-130	98.7	SH3 domain-bind...	Pongo abelii
EDM04540	6.3e-126	95.7	rCG34685, isofo...	Rattus norvegicus
Q99LH9	1.4e-123	94.7	SH3 domain-bind...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 88 301 PD023692 NULL

HMMPfam IPR007940 80 316 PF05276 SH3-binding 5

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	88	301	PD023692	NULL
HMMPfam	IPR007940	80	316	PF05276	SH3-binding 5

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGCAGTGCTCCCAGTTTGTAG

Primer_r
: AACCTCCCTCAACCTGTAGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: CCR
Primer_f	: GGCAGTGCTCCCAGTTTGTAG
Primer_r	: AACCTCCCTCAACCTGTAGAC
PCR product length	: 179 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1452 bp
Genome contig ID	gi89161185r_246971270
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GGTTTTATTTAAATAAAGTAGTTTATGTAACAGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATCTACTGTCCTTGCTGGAGGAAGAGAAAAGGGGCAAAGATGAGGCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	247071270	247086016	6	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1720

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information