HUGE |
Gene/Protein Characteristic Table for KIAA1717 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00270 |
---|---|
Accession No. : | AB051504 |
Description : | Histone-lysine N-methyltransferase, H3 lysine-4 specific SET7. |
HUGO Gene Name : | SET domain containing (lysine methyltransferase) 7 (SETD7) |
Clone Name : | pf00208 [Vector Info] |
Flexi ORF Clone : | pF1KA1717
![]() |
Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6992 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 5624 bp Genome contig ID gi89161207r_140546643 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
AGAAACAATGCAAGTATTAAACAAAATATACAATCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATCTGTCATTGTCTTCCTTTGGTCATCTAGGTTAGAAAAGCAATAATGGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 r 140646643 140697008 8 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 420 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CAAAAGTTAACCCCATCACGG | |
: TCATGCACCCAGACACACTAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 4 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |