HUGE

Gene/Protein Characteristic Table for KIAA1701

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00890
Accession No. :	AB051488
Description :	basic helix-loop-helix domain containing, class B, 9.
HUGO Gene Name :	basic helix-loop-helix domain containing, class B, 9 (BHLHB9)
Clone Name :	fj15383 [Vector Info]
Flexi ORF Clone :	pF1KSDA1701
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3827 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1800 bp

Genome contig ID gi89161218f_101789410
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACATCTTTGCATGTCAATAAATATGCCTCTACAAC
Flanking genome sequence
(104614 - 104663)
----+----*----+----*----+----*----+----*----+----*
ATATTTTTGAATCACTTAATATTTTTCCCATGTTAACAGTTGGTATATAG

Features of the protein sequence	Description

Length: 570 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6PI77	4.9e-214	100.0	Protein BHLHB9;...	Homo sapiens
XP_001083873	1.5e-208	97.4	similar to basi...	Macaca mulatta
Q9BE11	5.3e-208	97.1	Protein BHLHB9;...	Macaca fascicularis
XP_538118	3.3e-154	78.7	similar to basi...	Canis lupus fam...
XP_001788041	2.9e-149	73.5	similar to basi...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007903	3.1e-35	29.6	KIAA0443
AB011084	1.1e-11	22.3	KIAA0512

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006911 325 567 PF04826 Protein of unknown function DUF634

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006911	325	567	PF04826	Protein of unknown function DUF634

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCATTCCCAGGACATTTAGG

Primer_r
: TATACAGTGGGGGGAAGCAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1800 bp
Genome contig ID	gi89161218f_101789410
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACATCTTTGCATGTCAATAAATATGCCTCTACAAC
Flanking genome sequence (104614 - 104663)	----+--------+--------+--------+--------+----* ATATTTTTGAATCACTTAATATTTTTCCCATGTTAACAGTTGGTATATAG

Primer_f	: AGCATTCCCAGGACATTTAGG
Primer_r	: TATACAGTGGGGGGAAGCAAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1701

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information