HUGE

Gene/Protein Characteristic Table for KIAA1699

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04925
Accession No. :	AB051486
Description :	Exocyst complex component 4.
HUGO Gene Name :	exocyst complex component 4 (EXOC4)
Clone Name :	fj15278 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4132 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1230 bp

Genome contig ID gi89161213f_132488421
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
AAAAATGGAGAATTAAAAAGTGTTTTGAGAAGCTT
Flanking genome sequence
(912632 - 912681)
----+----*----+----*----+----*----+----*----+----*
AAATGTTTCATGTTATTTTTCTTGTGTTCTTTATTCAGCAAATATTCCCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 132588421 133401051 18 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 966 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96A65	100.0	Exocyst complex...	Homo sapiens
AAH67263	99.9	Exocyst complex...	Homo sapiens
XP_001139207	99.9	hypothetical pr...	Pan troglodytes
CAH90126	99.2	hypothetical pr...	Pongo abelii
XP_539369	96.9	similar to Exoc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007191 1 136 PF04048 Sec8 exocyst complex component specific domain

ScanRegExp IPR002464 181 190 PS00690 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007191	1	136	PF04048	Sec8 exocyst complex component specific domain
ScanRegExp	IPR002464	181	190	PS00690	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGTCTTTTGATCCCAGTCCG

Primer_r
: TTGCCTTTCATTCCTCCATAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1230 bp
Genome contig ID	gi89161213f_132488421
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- AAAAATGGAGAATTAAAAAGTGTTTTGAGAAGCTT
Flanking genome sequence (912632 - 912681)	----+--------+--------+--------+--------+----* AAATGTTTCATGTTATTTTTCTTGTGTTCTTTATTCAGCAAATATTCCCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	132588421	133401051	18	99.6	Perfect prediction

Primer_f	: AAGTCTTTTGATCCCAGTCCG
Primer_r	: TTGCCTTTCATTCCTCCATAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1699

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information