ROUGE

Gene/Protein Characteristic Table for mKIAA1699

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173235
Description :	Exocyst complex component Sec8.
Clone Name :	mid07054 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 3711 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 777 bp

Genome contig ID gi65504368f_33234797
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATACATGCAGGCAAAAATACTCATACACACAAAGT
Flanking genome sequence
(828552 - 828601)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAATGATCATAAAACTATTGCTAAAAATAGTAGGGAGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1699 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1699	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2934
Length: 977 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O35382	100.0	Exocyst complex...	Mus musculus
Q62824	98.4	Exocyst complex...	Rattus norvegicus
AAB86537	99.7	Sec8 [Mus muscu...	Mus musculus
XP_539369	95.8	similar to Exoc...	Canis lupus fam...
Q96A65	95.8	Exocyst complex...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007191 3 146 PF04048 Sec8 exocyst complex component specific domain

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007191	3	146	PF04048	Sec8 exocyst complex component specific domain

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	777 bp
Genome contig ID	gi65504368f_33234797
PolyA signal sequence (None)	+--------+--------+----*----+---- ATACATGCAGGCAAAAATACTCATACACACAAAGT
Flanking genome sequence (828552 - 828601)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAATGATCATAAAACTATTGCTAAAAATAGTAGGGAGG

Gene/Protein Characteristic Table for mKIAA1699

Features of the cloned DNA sequence

Features of the protein sequence