HUGE

Gene/Protein Characteristic Table for KIAA1696

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00889
Accession No. :	AB051483
Description :	PHD finger protein 21A.
HUGO Gene Name :	PHD finger protein 21A (PHF21A)
Clone Name :	fj12768 [Vector Info]
Flexi ORF Clone :	pF1KSDA1696
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3675 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1402 bp

Genome contig ID gi51511727r_45810693
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
AACAGTGATTTCTATTAAAAAGGTGTCAGAACTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGAAAATGCCGTGTAGTTATAATTTTTTAGCACAGACCCTGCTGATCACG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 45910693 46099305 18 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 635 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW68012	8.2e-188	100.0	PHD finger prot...	Homo sapiens
BAB14492	1.7e-187	99.8	unnamed protein...	Homo sapiens
XP_001112561	2.4e-187	99.5	similar to BRAF...	Macaca mulatta
XP_861897	1.7e-185	99.1	similar to BRAF...	Canis lupus fam...
XP_001251539	5.8e-183	97.5	similar to BRAF...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001965 445 490 PF00628 Zinc finger

HMMSmart IPR001965 445 488 SM00249 Zinc finger

ProfileScan IPR001965 443 490 PS50016 Zinc finger

ScanRegExp IPR001965 446 487 PS01359 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	445	490	PF00628	Zinc finger
HMMSmart	IPR001965	445	488	SM00249	Zinc finger
ProfileScan	IPR001965	443	490	PS50016	Zinc finger
ScanRegExp	IPR001965	446	487	PS01359	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACAGCTCAGCAATTCCATAAG

Primer_r
: TCAGAGTCTACAGGTTTGGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1402 bp
Genome contig ID	gi51511727r_45810693
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- AACAGTGATTTCTATTAAAAAGGTGTCAGAACTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAAAATGCCGTGTAGTTATAATTTTTTAGCACAGACCCTGCTGATCACG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	45910693	46099305	18	100.0	Perfect prediction

Primer_f	: ACAGCTCAGCAATTCCATAAG
Primer_r	: TCAGAGTCTACAGGTTTGGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1696

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information