HUGE

Gene/Protein Characteristic Table for KIAA1677

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05759
Accession No. :	AB051464
Description :	Kelch-like protein 15.
HUGO Gene Name :	kelch-like 15 (Drosophila) (KLHL15)
Clone Name :	fh18965 [Vector Info]
Flexi ORF Clone :	pF1KA1677
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5765 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4197 bp

Genome contig ID gi89161218r_23811762
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGAAGAAAAGTTTAAATAAAATATTTTTAATCTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATATACTTCTTTATCTCTGATTATTTGCTGTTTTTTGATATAATCCA

Features of the protein sequence	Description

Length: 521 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96M94	100.0	Kelch-like prot...	Homo sapiens
BAB71415	99.8	unnamed protein...	Homo sapiens
XP_001089787	99.8	similar to kelc...	Macaca mulatta
XP_528904	99.8	kelch-like 15 [...	Pan troglodytes
CAM26498	99.2	kelch-like 15 (...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037730	1.7e-38	30.6	KIAA1309
AB037775	1.2e-37	30.4	KIAA1354
AB037805	9.4e-28	28.1	KIAA1384
AB018338	2.2e-19	23.7	KIAA0795
D50922	6e-19	25.6	KIAA0132

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 2 45 PF00651 BTB/POZ

IPR011705 50 154 PF07707 BTB/Kelch-associated

IPR006652 233 283 PF01344 Kelch repeat type 1

IPR006652 285 330 PF01344 Kelch repeat type 1

IPR006652 332 392 PF01344 Kelch repeat type 1

IPR006652 394 446 PF01344 Kelch repeat type 1

IPR006652 448 494 PF01344 Kelch repeat type 1

HMMSmart IPR006652 245 296 SM00612 Kelch repeat type 1

IPR006652 297 343 SM00612 Kelch repeat type 1

IPR006652 344 405 SM00612 Kelch repeat type 1

IPR006652 406 459 SM00612 Kelch repeat type 1

IPR006652 460 509 SM00612 Kelch repeat type 1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	2	45	PF00651	BTB/POZ
IPR011705	50	154	PF07707	BTB/Kelch-associated
IPR006652	233	283	PF01344	Kelch repeat type 1
IPR006652	285	330	PF01344	Kelch repeat type 1
IPR006652	332	392	PF01344	Kelch repeat type 1
IPR006652	394	446	PF01344	Kelch repeat type 1
IPR006652	448	494	PF01344	Kelch repeat type 1
HMMSmart	IPR006652	245	296	SM00612	Kelch repeat type 1
IPR006652	297	343	SM00612	Kelch repeat type 1
IPR006652	344	405	SM00612	Kelch repeat type 1
IPR006652	406	459	SM00612	Kelch repeat type 1
IPR006652	460	509	SM00612	Kelch repeat type 1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 25 AMYVQLIEVVKFCCSFLLAKICL 47 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	25	AMYVQLIEVVKFCCSFLLAKICL	47	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTGTGTCCTCATTACTCTGC

Primer_r
: CCTTTACTATGACTCGAGCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: CCR
Primer_f	: TCTGTGTCCTCATTACTCTGC
Primer_r	: CCTTTACTATGACTCGAGCAG
PCR product length	: 137 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4197 bp
Genome contig ID	gi89161218r_23811762
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGAAGAAAAGTTTAAATAAAATATTTTTAATCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATATACTTCTTTATCTCTGATTATTTGCTGTTTTTTGATATAATCCA

Gene/Protein Characteristic Table for KIAA1677

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information