HUGE

Gene/Protein Characteristic Table for KIAA1674

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00885
Accession No. :	AB051461
Description :	Leucine-rich repeat-containing protein 27.
HUGO Gene Name :	leucine rich repeat containing 27 (LRRC27)
Clone Name :	fg03838 [Vector Info]
Flexi ORF Clone :	pF1KSDA1674
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6382 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4684 bp

Genome contig ID gi89161187f_133895694
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTTTGCAGATGAGCCACATAGCCTAGAAATATCTG
Flanking genome sequence
(147720 - 147769)
----+----*----+----*----+----*----+----*----+----*
AAAAAAGAAAAAGTTATGTCATGAATGCATAAAATATACAGACCATACAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 133995694 134043412 11 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 538 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9C0I9	5.3e-180	100.0	Leucine-rich re...	Homo sapiens
BAG53467	1.1e-179	99.8	unnamed protein...	Homo sapiens
XP_001144456	1.2e-170	95.8	leucine rich re...	Pan troglodytes
XP_001092022	1.3e-160	90.6	similar to leuc...	Macaca mulatta
CAI13019	1.1e-155	100.0	novel protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001611 76 98 PF00560 Leucine-rich repeat

IPR001611 100 121 PF00560 Leucine-rich repeat

IPR001611 123 144 PF00560 Leucine-rich repeat

HMMSmart IPR003591 74 97 SM00369 Leucine-rich repeat

IPR003591 98 121 SM00369 Leucine-rich repeat

IPR003591 122 144 SM00369 Leucine-rich repeat

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001611	76	98	PF00560	Leucine-rich repeat
IPR001611	100	121	PF00560	Leucine-rich repeat
IPR001611	123	144	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	74	97	SM00369	Leucine-rich repeat
IPR003591	98	121	SM00369	Leucine-rich repeat
IPR003591	122	144	SM00369	Leucine-rich repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAAGGAGGATGAGCTGCTGTC

Primer_r
: AAGATGATGCCTCCAACACCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCACAATGCCACCTGACTGAG
Primer_r	: GTGGCCTTTGGTGTAACTCTC
PCR product length	: 216 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	4684 bp
Genome contig ID	gi89161187f_133895694
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTTGCAGATGAGCCACATAGCCTAGAAATATCTG
Flanking genome sequence (147720 - 147769)	----+--------+--------+--------+--------+----* AAAAAAGAAAAAGTTATGTCATGAATGCATAAAATATACAGACCATACAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	133995694	134043412	11	99.2	Perfect prediction

Primer_f	: CAAGGAGGATGAGCTGCTGTC
Primer_r	: AAGATGATGCCTCCAACACCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1674

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information