HUGE

Gene/Protein Characteristic Table for KIAA1662

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07209
Accession No. :	AB051449
Description :	TRIO and F-actin-binding protein.
HUGO Gene Name :	TRIO and F-actin binding protein (TRIOBP)
Clone Name :	fj03879s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj03879, former representative clones for KIAA1662 with fj03879s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5562 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 345 bp

Genome contig ID gi89161203f_36350666
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTTTTTTCCTTTTTTTCCAAAACACTTTATACTTT
Flanking genome sequence
(149412 - 149461)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGCAATTCCTGGTGGCTGTGTGCCTCCAACCCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 f 36450661 36500076 18 99.2 Terminal No-hit

Features of the protein sequence	Description

Length: 1653 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
ABB59559	0	99.8	TRIOBP isoform ...	Homo sapiens
Q9H2D6	0	99.8	TRIO and F-acti...	Homo sapiens
XP_515120	0	98.3	TRIO and F-acti...	Pan troglodytes
EAW60185	0	99.8	TRIO and F-acti...	Homo sapiens
XP_001916851	5.8e-214	81.9	TRIO and F-acti...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020671	3.2e-13	45.5	KIAA0864

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 1067 1175 PF00169 Pleckstrin-like

HMMSmart IPR001849 1067 1177 SM00233 Pleckstrin-like

ProfileScan IPR001849 1066 1175 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	1067	1175	PF00169	Pleckstrin-like
HMMSmart	IPR001849	1067	1177	SM00233	Pleckstrin-like
ProfileScan	IPR001849	1066	1175	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCGCAGTGGAAGAAACATTGG

Primer_r
: GACAAGGTATAGACAGCATCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	345 bp
Genome contig ID	gi89161203f_36350666
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTTTTTCCTTTTTTTCCAAAACACTTTATACTTT
Flanking genome sequence (149412 - 149461)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGCAATTCCTGGTGGCTGTGTGCCTCCAACCCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	f	36450661	36500076	18	99.2	Terminal No-hit

Primer_f	: TCGCAGTGGAAGAAACATTGG
Primer_r	: GACAAGGTATAGACAGCATCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1662

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information