HUGE |
Gene/Protein Characteristic Table for KIAA1652 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05687 |
---|---|
Accession No. : | AB051439 |
Description : | |
HUGO Gene Name : | |
Clone Name : | hg02500 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6381 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3437 bp Genome contig ID gi89161203r_18156421 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GGGGCCCGGGGCTCATTGAGAAGGTGCGATTCCAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGAAGATAAATATTTTAAAATAATAAGCTTCAAGAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 18256421 18266559 2 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 179 aa
No significant homologues
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
RH mapping information |
Description | |
---|---|---|
: 22 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |