HUGE |
Gene/Protein Characteristic Table for KIAA1646 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04538 |
---|---|
Accession No. : | AB051433 |
Description : | Ceramide kinase. |
HUGO Gene Name : | ceramide kinase (CERK) |
Clone Name : | hk01650 [Vector Info] |
Flexi ORF Clone : | pF1KA1646
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4171 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2724 bp Genome contig ID gi89161203r_45358972 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TGTTTGAGAAGACACGAATAAAGTTACTTGGGCAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACTTGGCTTGCTTTCTTTCCTTTACACATACCTGTTATTTTCAAAGCAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 45458972 45495551 12 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 481 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001206 | 75 | 196 | PD005043 | Diacylglycerol kinase |
HMMPfam | IPR001206 | 76 | 221 | PF00781 | Diacylglycerol kinase |
HMMSmart | IPR001206 | 76 | 222 | SM00046 | Diacylglycerol kinase |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
RH mapping information |
Description | |
---|---|---|
: 22 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |