HUGE

Gene/Protein Characteristic Table for KIAA1628

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB046848
Description :	neighbor of Punc E11.
HUGO Gene Name :
Clone Name :	fh14247 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5569 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 2526 bp

Genome contig ID gi51511731r_63360878
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
CTGTCCTTATAATGAATTAATAAACTATTTTCCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATGTGGAATTCTCTTTTGGAACCATTGACCATGACTAGAATTTCCTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 63460878 63475820 14 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 980 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001174407	99.4	DDM36 isoform 1...	Pan troglodytes
XP_001174411	99.1	DDM36 isoform 2...	Pan troglodytes
Q8TDY8	96.4	Neighbor of pun...	Homo sapiens
EAW77723	96.4	likely ortholog...	Homo sapiens
EAW77724	96.4	likely ortholog...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032958	1.7e-05	23.0	KIAA1132
AB040947	2.3e-05	23.9	KIAA1514
AB046788	0.00037	26.1	KIAA1568
AB040929	0.00045	22.2	KIAA1496

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013098 65 152 PF07679 Immunoglobulin I-set

IPR003961 159 245 PF00041 Fibronectin

IPR003961 257 343 PF00041 Fibronectin

IPR003961 360 459 PF00041 Fibronectin

IPR003961 480 565 PF00041 Fibronectin

IPR003961 577 665 PF00041 Fibronectin

HMMSmart IPR003599 71 153 SM00409 Immunoglobulin subtype

IPR003598 77 142 SM00408 Immunoglobulin subtype 2

IPR003961 159 242 SM00060 Fibronectin

IPR003961 257 340 SM00060 Fibronectin

IPR003961 360 456 SM00060 Fibronectin

IPR003961 480 562 SM00060 Fibronectin

IPR003961 578 662 SM00060 Fibronectin

ProfileScan IPR007110 65 151 PS50835 Immunoglobulin-like

IPR003961 159 252 PS50853 Fibronectin

IPR003961 257 349 PS50853 Fibronectin

IPR003961 360 465 PS50853 Fibronectin

IPR003961 479 572 PS50853 Fibronectin

IPR003961 577 672 PS50853 Fibronectin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013098	65	152	PF07679	Immunoglobulin I-set
IPR003961	159	245	PF00041	Fibronectin
IPR003961	257	343	PF00041	Fibronectin
IPR003961	360	459	PF00041	Fibronectin
IPR003961	480	565	PF00041	Fibronectin
IPR003961	577	665	PF00041	Fibronectin
HMMSmart	IPR003599	71	153	SM00409	Immunoglobulin subtype
IPR003598	77	142	SM00408	Immunoglobulin subtype 2
IPR003961	159	242	SM00060	Fibronectin
IPR003961	257	340	SM00060	Fibronectin
IPR003961	360	456	SM00060	Fibronectin
IPR003961	480	562	SM00060	Fibronectin
IPR003961	578	662	SM00060	Fibronectin
ProfileScan	IPR007110	65	151	PS50835	Immunoglobulin-like
IPR003961	159	252	PS50853	Fibronectin
IPR003961	257	349	PS50853	Fibronectin
IPR003961	360	465	PS50853	Fibronectin
IPR003961	479	572	PS50853	Fibronectin
IPR003961	577	672	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 685 SVTGIIVGVCLGLLCLLACMCAG 707 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	685	SVTGIIVGVCLGLLCLLACMCAG	707	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGAAAGTGAAGCAGTATGAGC

Primer_r
: GAGCTGTTTGATTCCGCATGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	2526 bp
Genome contig ID	gi51511731r_63360878
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CTGTCCTTATAATGAATTAATAAACTATTTTCCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGTGGAATTCTCTTTTGGAACCATTGACCATGACTAGAATTTCCTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	63460878	63475820	14	99.3	Perfect prediction

Primer_f	: AGAAAGTGAAGCAGTATGAGC
Primer_r	: GAGCTGTTTGATTCCGCATGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1628

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information